algorithms prism graphpad software version 9 fiji nih (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
99
Structured Review
Bio-Rad
algorithms prism graphpad software version 9 fiji nih
Algorithms Prism Graphpad Software Version 9 Fiji Nih, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36344 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+prism+graphpad+software+version+9+fiji+nih/Image+Lab+Software/pm38088930-231-91-105
Average 99 stars, based on 36344 article reviews
Algorithms Prism Graphpad Software Version 9 Fiji Nih, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36344 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+prism+graphpad+software+version+9+fiji+nih/Image+Lab+Software/pm38088930-231-91-105
Average 99 stars, based on 36344 article reviews
algorithms prism graphpad software version 9 fiji nih - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Recombinant:Article Title: Cell stretching activates an ATM mechano-transduction pathway that remodels cytoskeleton and chromatin. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 488 phalloidin ThermoFisher A12379 Alexa Fluor 568 phalloidin ThermoFisher A12380 DAPI Sigma-Aldrich D9542 Fibronectin Sigma-Aldrich 11080938001 Deposited data Mass spectrometry data PRIDE PXD032194; https://data.mendeley.com/ preview/8zrx4hvw3c?a=4337fb63-f7e84022-8ab7-f8a46180b7e3 Experimental models: Cell lines HeLa ATCC CRM-CCL-2, RRID:CVCL_0030 .. Oligonucleotides Cas9 guide forward: ATM1: CACCGCGAATTCGAGTGTGTGAATT This paper N/A Cas9 guide reverse: ATM2: AAACAATTCACACACTCGAATTCGC This paper N/A Recombinant DNA H2B-fused ATM FRET reporter Tony Hunter39 N/A WC ATM FRET reporter Tony Hunter39 N/A T68A ATM FRET reporter Tony Hunter39 N/A GFP-Arp3 This paper N/A LifeAct-mCherry This paper N/A LentiCRISPR 49535 addgene Feng Zhang104 49535 pLenti6/BLOCK-iTTM-DEST ThermoFisher K4944-00 pLKO.1-puro Sigma-Aldrich SHC001 shCBX1 Sigma-Aldrich TRCN0000062223 pcDNA nesprin TS addgene Daniel Conway64 68127 pcDNA nesprin HL addgene Daniel Conway64 68128 pTRIP-CMV-GFP-FLAG-cGAS addgene Matthieu Piel34 86675 pAcGFP1-C1 clontech 632470 53BP1-GFP Jiri Bartek105 N/A Software and Software:Article Title: Cell stretching activates an ATM mechano-transduction pathway that remodels cytoskeleton and chromatin. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 488 phalloidin ThermoFisher A12379 Alexa Fluor 568 phalloidin ThermoFisher A12380 DAPI Sigma-Aldrich D9542 Fibronectin Sigma-Aldrich 11080938001 Deposited data Mass spectrometry data PRIDE PXD032194; https://data.mendeley.com/ preview/8zrx4hvw3c?a=4337fb63-f7e84022-8ab7-f8a46180b7e3 Experimental models: Cell lines HeLa ATCC CRM-CCL-2, RRID:CVCL_0030 .. Oligonucleotides Cas9 guide forward: ATM1: CACCGCGAATTCGAGTGTGTGAATT This paper N/A Cas9 guide reverse: ATM2: AAACAATTCACACACTCGAATTCGC This paper N/A Recombinant DNA H2B-fused ATM FRET reporter Tony Hunter39 N/A WC ATM FRET reporter Tony Hunter39 N/A T68A ATM FRET reporter Tony Hunter39 N/A GFP-Arp3 This paper N/A LifeAct-mCherry This paper N/A LentiCRISPR 49535 addgene Feng Zhang104 49535 pLenti6/BLOCK-iTTM-DEST ThermoFisher K4944-00 pLKO.1-puro Sigma-Aldrich SHC001 shCBX1 Sigma-Aldrich TRCN0000062223 pcDNA nesprin TS addgene Daniel Conway64 68127 pcDNA nesprin HL addgene Daniel Conway64 68128 pTRIP-CMV-GFP-FLAG-cGAS addgene Matthieu Piel34 86675 pAcGFP1-C1 clontech 632470 53BP1-GFP Jiri Bartek105 N/A Software and |